View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1872_low_4 (Length: 249)
Name: NF1872_low_4
Description: NF1872
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1872_low_4 |
 |  |
|
| [»] chr1 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 198; Significance: 1e-108; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 198; E-Value: 1e-108
Query Start/End: Original strand, 13 - 249
Target Start/End: Original strand, 10117004 - 10117238
Alignment:
| Q |
13 |
aatatgtagcaatgatggtttggactaatggtgcgttaacatcgacacatgtagttagattcaatcacttcaattannnnnnnnnaactttttacatgtt |
112 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
10117004 |
aatatgtagcaatgatggtttggactaatggtgtgttaacatcgacacatgtagttagattcaatcacttcaatt--ttttttttaactttttacatgtt |
10117101 |
T |
 |
| Q |
113 |
tacttgttgatgtcagcatcgtgtagcgtcatgtctggtgtatgtatctatgtcggtacttcataagtgtgataggactgaattgttgaataaaaaagat |
212 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10117102 |
tacttgttgatgtcagcatcgtgtagcgtcatgtctggtgtatgtatctatgtcggtacttcataagtgtgataggactgaattgttgaataaaaaagat |
10117201 |
T |
 |
| Q |
213 |
ttacatgattggcatatagattgaatactatacatga |
249 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10117202 |
ttacatgattggcatatagattgaatactatacatga |
10117238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University