View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18731_high_5 (Length: 314)
Name: NF18731_high_5
Description: NF18731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18731_high_5 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 47; Significance: 8e-18; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 268 - 314
Target Start/End: Complemental strand, 21556443 - 21556397
Alignment:
| Q |
268 |
ctcttcagttttgcaaatgggatctctcgtttaaagtacactgatat |
314 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21556443 |
ctcttcagttttgcaaatgggatctctcgtttaaagtacactgatat |
21556397 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 49 - 126
Target Start/End: Complemental strand, 3179104 - 3179026
Alignment:
| Q |
49 |
cctgcagaattatttgaagagggtggaaatgattagaaaaactattacatga-aaaggtgataaaagagaaacaacaaa |
126 |
Q |
| |
|
|||||||||||||||||||| || |||| ||||||||| ||||| ||||| ||||||||| ||| |||||||||||| |
|
|
| T |
3179104 |
cctgcagaattatttgaagatggataaaattattagaaaagctattgcatgagaaaggtgatgaaatagaaacaacaaa |
3179026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 75 - 126
Target Start/End: Original strand, 33233021 - 33233073
Alignment:
| Q |
75 |
aaatgattagaaaaactattacatga-aaaggtgataaaagagaaacaacaaa |
126 |
Q |
| |
|
|||| ||||||||| ||||||||||| ||||||||| || ||||||||||||| |
|
|
| T |
33233021 |
aaattattagaaaagctattacatgagaaaggtgatgaatgagaaacaacaaa |
33233073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University