View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18731_low_12 (Length: 239)
Name: NF18731_low_12
Description: NF18731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18731_low_12 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 205; Significance: 1e-112; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 205; E-Value: 1e-112
Query Start/End: Original strand, 17 - 229
Target Start/End: Original strand, 47423585 - 47423797
Alignment:
| Q |
17 |
acaatctagtactatttcttcaacttccacggccaatccacttcaccggtgatgaatcatgatcaacgattctcgtccgccgtcttcgacttccacgacc |
116 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47423585 |
acaatctagtactatttcttcaactttcacggccactccacttcaccggtgatgaatcatgatcaacgattctcgtccgccgtcttcgacttccacgacc |
47423684 |
T |
 |
| Q |
117 |
ttccccaaagcaaagcgcaaatgacttcaccagtgatgaatccatgactgtggttgtcactagctgtttttgtcatcacatcgtcaatgttcatttgctt |
216 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47423685 |
ttccccaaagcaaagcgcaaatgacttcaccagtgatgaatccatgactgtggttgtcactagctgtttttgtcatcacatcgtcaatgttcatttgctt |
47423784 |
T |
 |
| Q |
217 |
tcgttcgtctgtg |
229 |
Q |
| |
|
||||||||||||| |
|
|
| T |
47423785 |
tcgttcgtctgtg |
47423797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University