View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18731_low_13 (Length: 223)
Name: NF18731_low_13
Description: NF18731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18731_low_13 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 153; Significance: 3e-81; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 1 - 201
Target Start/End: Complemental strand, 38091181 - 38090983
Alignment:
| Q |
1 |
cacaaatttgcacaaccaaattgcagtatcaacacaacactccacaacgactcaagagaccaagtttatttacttctcagttaacgtggacgaatgatac |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
38091181 |
cacaaatttgcacaaccaaattgcagtatcaacacaacactccacaacgactcaagagaccaagtt-atttacttctcagttaacatggacgaatgatac |
38091083 |
T |
 |
| Q |
101 |
ttctgttagccttgacagaaagtttctaatatatagtaaataaaagttaaaattacacgatttggcccttaatttaatttattgataaactcttacgttc |
200 |
Q |
| |
|
|| ||||| ||||||||||||||||||||||||||||||||||||| |||| |||||| ||| | ||||||||||||||||||||| ||||||||||||| |
|
|
| T |
38091082 |
ttttgttaaccttgacagaaagtttctaatatatagtaaataaaaggtaaatttacacaattcgacccttaatttaatttattgat-aactcttacgttc |
38090984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 67 - 131
Target Start/End: Complemental strand, 38095906 - 38095842
Alignment:
| Q |
67 |
tatttacttctcagttaacgtggacgaatgatacttctgttagccttgacagaaagtttctaata |
131 |
Q |
| |
|
|||||||||||| |||||| |||||||||| ||||| |||| |||| |||||||||||||||||| |
|
|
| T |
38095906 |
tatttacttctctgttaacatggacgaatggtacttttgttggcctagacagaaagtttctaata |
38095842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University