View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18731_low_5 (Length: 314)

Name: NF18731_low_5
Description: NF18731
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18731_low_5
NF18731_low_5
[»] chr8 (1 HSPs)
chr8 (268-314)||(21556397-21556443)
[»] chr6 (1 HSPs)
chr6 (49-126)||(3179026-3179104)
[»] chr4 (1 HSPs)
chr4 (75-126)||(33233021-33233073)


Alignment Details
Target: chr8 (Bit Score: 47; Significance: 8e-18; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 268 - 314
Target Start/End: Complemental strand, 21556443 - 21556397
Alignment:
268 ctcttcagttttgcaaatgggatctctcgtttaaagtacactgatat 314  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
21556443 ctcttcagttttgcaaatgggatctctcgtttaaagtacactgatat 21556397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 49 - 126
Target Start/End: Complemental strand, 3179104 - 3179026
Alignment:
49 cctgcagaattatttgaagagggtggaaatgattagaaaaactattacatga-aaaggtgataaaagagaaacaacaaa 126  Q
    |||||||||||||||||||| ||   |||| ||||||||| ||||| ||||| ||||||||| ||| ||||||||||||    
3179104 cctgcagaattatttgaagatggataaaattattagaaaagctattgcatgagaaaggtgatgaaatagaaacaacaaa 3179026  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 75 - 126
Target Start/End: Original strand, 33233021 - 33233073
Alignment:
75 aaatgattagaaaaactattacatga-aaaggtgataaaagagaaacaacaaa 126  Q
    |||| ||||||||| ||||||||||| ||||||||| || |||||||||||||    
33233021 aaattattagaaaagctattacatgagaaaggtgatgaatgagaaacaacaaa 33233073  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University