View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18732_low_7 (Length: 369)
Name: NF18732_low_7
Description: NF18732
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18732_low_7 |
 | |
|
| [»] scaffold0006 (1 HSPs) |
| | |
|
Alignment Details
Target: scaffold0006 (Bit Score: 174; Significance: 2e-93; HSPs: 1)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 174; E-Value: 2e-93
Query Start/End: Original strand, 25 - 258
Target Start/End: Original strand, 82515 - 82750
Alignment:
| Q |
25 |
aataaaagaaatgcagtaagaatcagactaataatataagggagggactagagaattaccgagatagaaggagaattacatcacaca----tacttcata |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| || ||||||||| |
|
|
| T |
82515 |
aataaaagaaatgcagtaagaatcagactaataatataagggagggactagagaattagtgagatagaaggagaattacatcactcacgcatacttcata |
82614 |
T |
|
| Q |
121 |
accctttttctcatctctttgtaagatatctacccatgtagtcactaaaatgtgatggttatctttaggaatacagttgtttcttctaacagtttgttgt |
220 |
Q |
| |
|
||| |||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
82615 |
accatttttctcatctctttgtaagatatctacccatgtagtcaataaaatgtgatggttatgtttaggaatacagttgtttcttctaacagtttgttgt |
82714 |
T |
|
| Q |
221 |
acaaggcccacgttacctgcctgaatcaacggccacat |
258 |
Q |
| |
|
| |||||||||||||||||||||||| |||||||| |
|
|
| T |
82715 |
--gatgcccacgttacctgcctgaatcaatggccacat |
82750 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University