View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18733_low_10 (Length: 281)
Name: NF18733_low_10
Description: NF18733
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18733_low_10 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 247; Significance: 1e-137; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 247; E-Value: 1e-137
Query Start/End: Original strand, 1 - 265
Target Start/End: Complemental strand, 1160277 - 1160016
Alignment:
| Q |
1 |
tggaagtggaatgggaggaagaggaattggtagaggaaggtcaggtggagcagctgcaggaattatcggcggtgcagtggctggtggagttgctggtgga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1160277 |
tggaagtggaatgggaggaagaggaattggtagaggaaggtcaggtggagcagctgcaggaattatcggcggtgcagtggctggtggagttgctggtgga |
1160178 |
T |
|
| Q |
101 |
gtggttggtggtgcagtcgccaatcacgggcacaattatgaacacaaacaccttcatgtttgtgtcccaacatttattttatgtttgagttttttgcttt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1160177 |
gtggttggtggtgcagtcgccaatcacgggcacaattatggacacaaacaccttcatgtttgtgtcccaacatttattttatgtttgagttttttgcttt |
1160078 |
T |
|
| Q |
201 |
aatcatgttgttttacttccacagctaattaagtatcatgtttagttgcttctgtttaggcctat |
265 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1160077 |
aatcatgttgttttacttcca---ctaattaagtatcatgtttagttgcttctgtttaggcctat |
1160016 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 156 - 222
Target Start/End: Complemental strand, 1141737 - 1141671
Alignment:
| Q |
156 |
atgtttgtgtcccaacatttattttatgtttgagttttttgctttaatcatgttgttttacttccac |
222 |
Q |
| |
|
||||||||||| |||||||||||||||||||||| |||| | | ||||||| |||||| |||||||| |
|
|
| T |
1141737 |
atgtttgtgtctcaacatttattttatgtttgagcttttggttataatcatattgtttcacttccac |
1141671 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 156 - 222
Target Start/End: Complemental strand, 1137083 - 1137017
Alignment:
| Q |
156 |
atgtttgtgtcccaacatttattttatgtttgagttttttgctttaatcatgttgttttacttccac |
222 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||| |||| |||||||| | |||||| |||||||| |
|
|
| T |
1137083 |
atgtttgtgtctcaacatttcttttatgtttgagcttttggctttaattacattgtttcacttccac |
1137017 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University