View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18734_high_17 (Length: 201)

Name: NF18734_high_17
Description: NF18734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18734_high_17
NF18734_high_17
[»] chr7 (1 HSPs)
chr7 (16-51)||(19279251-19279286)
[»] chr3 (1 HSPs)
chr3 (16-51)||(54653138-54653173)
[»] chr1 (1 HSPs)
chr1 (16-51)||(3978492-3978527)


Alignment Details
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 16 - 51
Target Start/End: Original strand, 19279251 - 19279286
Alignment:
16 atgaatatggaagtgtgaagatactgattgatgaaa 51  Q
    ||||||||||||||||||||||||||||||||||||    
19279251 atgaatatggaagtgtgaagatactgattgatgaaa 19279286  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 16 - 51
Target Start/End: Complemental strand, 54653173 - 54653138
Alignment:
16 atgaatatggaagtgtgaagatactgattgatgaaa 51  Q
    ||||||||||||||||||||||||||||||||||||    
54653173 atgaatatggaagtgtgaagatactgattgatgaaa 54653138  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 16 - 51
Target Start/End: Complemental strand, 3978527 - 3978492
Alignment:
16 atgaatatggaagtgtgaagatactgattgatgaaa 51  Q
    ||||||||||||||||||||||| ||||||||||||    
3978527 atgaatatggaagtgtgaagatattgattgatgaaa 3978492  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University