View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18734_high_18 (Length: 201)
Name: NF18734_high_18
Description: NF18734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18734_high_18 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 133; Significance: 2e-69; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 133; E-Value: 2e-69
Query Start/End: Original strand, 21 - 192
Target Start/End: Complemental strand, 12804529 - 12804345
Alignment:
| Q |
21 |
tgcctcacccttattttcaattgcatagtcat-------------ctcaactagctacacctttggagaaatgcgccttgatcttgtttctggaagacca |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12804529 |
tgcctcacccttattttcaattgcatagtcatggattaattaatcctaaactagctacacctttggagaaatgcgccttgatcttgtttctggaagacca |
12804430 |
T |
 |
| Q |
108 |
atgaacaattcagtctccacatctgaacttggactactttgatctgcataaggttcagcttcagctatattttctctctgctcct |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
12804429 |
atgaacaattcagtctccacatctgaacttggactactttgatctgcataaggttcagcttcagctatattttctctctgatcct |
12804345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 120; E-Value: 1e-61
Query Start/End: Original strand, 53 - 192
Target Start/End: Complemental strand, 12780994 - 12780855
Alignment:
| Q |
53 |
ctcaactagctacacctttggagaaatgcgccttgatcttgtttctggaagaccaatgaacaattcagtctccacatctgaacttggactactttgatct |
152 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
| T |
12780994 |
ctcaactagctacacctttggagaaatgcgccttgttcttgtttctggaagaccaatgaacaattcagtttccacatctgaacttggactactttgatct |
12780895 |
T |
 |
| Q |
153 |
gcataaggttcagcttcagctatattttctctctgctcct |
192 |
Q |
| |
|
||||||| |||||||||| |||||||||||||||| |||| |
|
|
| T |
12780894 |
gcataagtttcagcttcaactatattttctctctgatcct |
12780855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University