View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18734_low_17 (Length: 201)
Name: NF18734_low_17
Description: NF18734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18734_low_17 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 16 - 51
Target Start/End: Original strand, 19279251 - 19279286
Alignment:
| Q |
16 |
atgaatatggaagtgtgaagatactgattgatgaaa |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
19279251 |
atgaatatggaagtgtgaagatactgattgatgaaa |
19279286 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 36; Significance: 0.00000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 16 - 51
Target Start/End: Complemental strand, 54653173 - 54653138
Alignment:
| Q |
16 |
atgaatatggaagtgtgaagatactgattgatgaaa |
51 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |
|
|
| T |
54653173 |
atgaatatggaagtgtgaagatactgattgatgaaa |
54653138 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 16 - 51
Target Start/End: Complemental strand, 3978527 - 3978492
Alignment:
| Q |
16 |
atgaatatggaagtgtgaagatactgattgatgaaa |
51 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
3978527 |
atgaatatggaagtgtgaagatattgattgatgaaa |
3978492 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University