View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18734_low_5 (Length: 385)
Name: NF18734_low_5
Description: NF18734
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18734_low_5 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 326; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 326; E-Value: 0
Query Start/End: Original strand, 1 - 374
Target Start/End: Original strand, 26449262 - 26449635
Alignment:
| Q |
1 |
agagattgcaaatggatgtagtatgaaagcctctaagagagaggttatcatctgtaggaagcttgttatgcaacagtctccaaacaagcacggacttaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
26449262 |
agagattgcaaatggatgtagtatgacagcctctaagagagaggttatcatctgtaggaagcttgttatgcaacagtctccaaacaagcaaggacttaga |
26449361 |
T |
|
| Q |
101 |
aggagggatagcaatgtgccaaatgactttggcccaactgatgttctgaggctgattggaagtcaggaagagatatgcgtctttaaaagctagatttcca |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
26449362 |
aggagggatagcaatgtgccaaatgactttggcccaactgatgttctgaggctgattggaagtcaggaagagatatgcgtctttaaaagctaaatttcca |
26449461 |
T |
|
| Q |
201 |
tcatgagaggctttctatattagtttatcttctttagggaaaataggtatagtagtcaacaatagtttctgctgcaaagcaggatatgcaggcaaagaag |
300 |
Q |
| |
|
||||||||||||||| |||||||||||||||||||||||| ||||||||||||||||| ||||||||| |||| |||||||| ||||||| |||| ||| |
|
|
| T |
26449462 |
tcatgagaggctttccatattagtttatcttctttagggacaataggtatagtagtcatcaatagtttttgctccaaagcagaatatgcaaccaaaaaag |
26449561 |
T |
|
| Q |
301 |
cttgaggaacattccaatttgaatctttgatgtaggtatccacattagattgcagaagatgatgtaaattctga |
374 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26449562 |
cttgaggaacattccaatttgaatctttgatgtaggtatccacattagattgcagaagatgatgtaaattctga |
26449635 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University