View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18735_low_11 (Length: 237)
Name: NF18735_low_11
Description: NF18735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18735_low_11 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 19 - 219
Target Start/End: Original strand, 14018734 - 14018934
Alignment:
| Q |
19 |
atgttgattctaacgatgaccgcgtcaatctccaaaaataaaaactcatagtatagctcatattcaggactaaaacgatggcctaatcggtgtgattcaa |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14018734 |
atgttgattctaacgatgaccgcgtcaatctccaaaaataaaaactcatagtatagctcatattcaggactaaaacgatggcctaatcggtgtgattcaa |
14018833 |
T |
 |
| Q |
119 |
caaaagctaagataaatcaatatgtggttcaaaactcaaattatattcattttgccttatgatctagtcatctcttttcttagtagtatacatatatgtt |
218 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14018834 |
caaaaactaagataaatcaatatgtggttcaaaactcaaattatattcattttgccttatgatctagtcatctcttttcttagtagtatacatatatgtt |
14018933 |
T |
 |
| Q |
219 |
t |
219 |
Q |
| |
|
| |
|
|
| T |
14018934 |
t |
14018934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University