View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18735_low_11 (Length: 237)

Name: NF18735_low_11
Description: NF18735
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18735_low_11
NF18735_low_11
[»] chr5 (1 HSPs)
chr5 (19-219)||(14018734-14018934)


Alignment Details
Target: chr5 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 19 - 219
Target Start/End: Original strand, 14018734 - 14018934
Alignment:
19 atgttgattctaacgatgaccgcgtcaatctccaaaaataaaaactcatagtatagctcatattcaggactaaaacgatggcctaatcggtgtgattcaa 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14018734 atgttgattctaacgatgaccgcgtcaatctccaaaaataaaaactcatagtatagctcatattcaggactaaaacgatggcctaatcggtgtgattcaa 14018833  T
119 caaaagctaagataaatcaatatgtggttcaaaactcaaattatattcattttgccttatgatctagtcatctcttttcttagtagtatacatatatgtt 218  Q
    ||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14018834 caaaaactaagataaatcaatatgtggttcaaaactcaaattatattcattttgccttatgatctagtcatctcttttcttagtagtatacatatatgtt 14018933  T
219 t 219  Q
    |    
14018934 t 14018934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University