View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18737_high_29 (Length: 273)
Name: NF18737_high_29
Description: NF18737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18737_high_29 |
 | |
|
| [»] scaffold0179 (1 HSPs) |
| | |
|
Alignment Details
Target: chr6 (Bit Score: 116; Significance: 4e-59; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 116; E-Value: 4e-59
Query Start/End: Original strand, 48 - 171
Target Start/End: Complemental strand, 895103 - 894980
Alignment:
| Q |
48 |
attgtgtctttgattatgggttaattgtatgcggtttgcatttatatagaaagttttgtgtttttgcgtatggctctatgtatgtaagtttcgattttcc |
147 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
895103 |
attgtgtctttgattatgggttaattgtatgcagtttgcatttatatagaaagttttgtgtttttgcgtatggctctatgtatgtaagtttcgatttttc |
895004 |
T |
|
| Q |
148 |
atatgtcttttatgaatatgatcg |
171 |
Q |
| |
|
|||||||||||||||||||||||| |
|
|
| T |
895003 |
atatgtcttttatgaatatgatcg |
894980 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0179 (Bit Score: 52; Significance: 7e-21; HSPs: 1)
Name: scaffold0179
Description:
Target: scaffold0179; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 48 - 115
Target Start/End: Original strand, 5305 - 5372
Alignment:
| Q |
48 |
attgtgtctttgattatgggttaattgtatgcggtttgcatttatatagaaagttttgtgtttttgcg |
115 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||||||| ||||| |||||||||| |
|
|
| T |
5305 |
attgtgtctttgattatgagttaattgtatgcagtttgcatttatatagaatgttttttgtttttgcg |
5372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University