View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18737_high_47 (Length: 212)
Name: NF18737_high_47
Description: NF18737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18737_high_47 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 164; Significance: 8e-88; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 164; E-Value: 8e-88
Query Start/End: Original strand, 20 - 207
Target Start/End: Complemental strand, 32164673 - 32164486
Alignment:
| Q |
20 |
tgaacggttatctccagctttacaagactcaatttcagaacatgcacatctgcggtagggtgattataaaaccagtccagctgcttgttaagaaggtaat |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32164673 |
tgaacggttatctccagctttacaagactcattttcagaacatgcacatctccggtagggtgattataaaaccagtccagctgcttgttaagaaggtaat |
32164574 |
T |
 |
| Q |
120 |
ttttctttatgatcacacacgatcatgaaaaaagtagatatgatcaaactgccacattgacatgtgtagtattgatgatgtccatctc |
207 |
Q |
| |
|
|||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||| ||| ||||||||| |
|
|
| T |
32164573 |
ttttctttatgatcacacacgatcatgagcaaagtagatatgatcaaactgccacattgacatgtgtagtattgttgacgtccatctc |
32164486 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University