View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18737_low_46 (Length: 236)
Name: NF18737_low_46
Description: NF18737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18737_low_46 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 31 - 230
Target Start/End: Complemental strand, 7382558 - 7382354
Alignment:
| Q |
31 |
ccaatcaaagtttcttgcttttgcaagaaagcaacttggccaataataataattaaataaaatgacagatccaa-----ttatgttttagttttttattt |
125 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | | | ||| ||||||||||||||||||||| |
|
|
| T |
7382558 |
ccaatcaaagtttcttgcttttgcaagaaagcaacttggccaataataataattaaataaatgaattgttgcaactcaattatgttttagttttttattt |
7382459 |
T |
 |
| Q |
126 |
gtgacatgaaaatgacagatccaacatgaacatcaaatggatcgaaataacagtaattttttggtcaaaatgacacgtaactaactttctagtataatat |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7382458 |
gtgacatgaaaatgacagatccaacatgaacatcaaatggatcgaaataacagtaattttttggtcaaaatgacacgtaactaactttctagtataatat |
7382359 |
T |
 |
| Q |
226 |
tattg |
230 |
Q |
| |
|
||||| |
|
|
| T |
7382358 |
tattg |
7382354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University