View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18737_low_50 (Length: 217)
Name: NF18737_low_50
Description: NF18737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18737_low_50 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 176; Significance: 5e-95; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 176; E-Value: 5e-95
Query Start/End: Original strand, 12 - 199
Target Start/End: Complemental strand, 4936592 - 4936405
Alignment:
| Q |
12 |
gaagaatatgagagaggaatatgggaaattgaacagggtagagatgagcatatgggaatgttgtgaacttttgaatgaagtggtggatgaaagtgaccct |
111 |
Q |
| |
|
|||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
4936592 |
gaagaaaatgagagaagaatatgggaaattgaacagggtagagatgagcatatgggaatgttgtgaacttctgaatgaagtggtggatgaaagtgaccct |
4936493 |
T |
|
| Q |
112 |
gacttggatgaaccacaaattgagcatttgctacaaacagctgaagctataagaaaggactacccaaatgaagattggctgcacttaa |
199 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
4936492 |
gacttggatgaaccacaaattgagcatttgctacaaacagctgaagctataagaaaggactacccaaatgaagattggctgcacttaa |
4936405 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 55 - 189
Target Start/End: Original strand, 42953806 - 42953940
Alignment:
| Q |
55 |
atgagcatatgggaatgttgtgaacttttgaatgaagtggtggatgaaagtgaccctgacttggatgaaccacaaattgagcatttgctacaaacagctg |
154 |
Q |
| |
|
|||||||| ||||||||||||||| | | ||||| || |||||||||||||| ||||| |||||||||||||||||| | |||||||| ||| | |||| |
|
|
| T |
42953806 |
atgagcatttgggaatgttgtgaattgctaaatgaggttgtggatgaaagtgatcctgatttggatgaaccacaaattcaacatttgctgcaatccgctg |
42953905 |
T |
|
| Q |
155 |
aagctataagaaaggactacccaaatgaagattgg |
189 |
Q |
| |
|
||||||| ||||| || || || |||||||||||| |
|
|
| T |
42953906 |
aagctattagaaaagattatcctaatgaagattgg |
42953940 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University