View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18737_low_51 (Length: 216)
Name: NF18737_low_51
Description: NF18737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18737_low_51 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 131; Significance: 4e-68; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 67 - 201
Target Start/End: Complemental strand, 32856328 - 32856194
Alignment:
| Q |
67 |
aatgacaaaggttagtaattagttgttaaatttagatctatttctttgtccacgttcgaacccagaacccccaactctttctctcttaactcaaagcaag |
166 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32856328 |
aatgacaaaggttagtaattagttgttaaatttagatctatttctctgtccacgttcgaacccagaacccccaactctttctctcttaactcaaagcaag |
32856229 |
T |
 |
| Q |
167 |
agctatccaaccctctctcatccgtggtttctaat |
201 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |
|
|
| T |
32856228 |
agctatccaaccctctctcatccgtggtttctaat |
32856194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 66 - 98
Target Start/End: Original strand, 10223394 - 10223426
Alignment:
| Q |
66 |
taatgacaaaggttagtaattagttgttaaatt |
98 |
Q |
| |
|
|||||||||| |||||||||||||||||||||| |
|
|
| T |
10223394 |
taatgacaaatgttagtaattagttgttaaatt |
10223426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University