View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18737_low_56 (Length: 210)
Name: NF18737_low_56
Description: NF18737
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18737_low_56 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 163; Significance: 3e-87; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 163; E-Value: 3e-87
Query Start/End: Original strand, 13 - 191
Target Start/End: Complemental strand, 5878972 - 5878794
Alignment:
| Q |
13 |
gaagaaaatattatttcaatagaatttaaatgataagaataaaatatgggttgtaagagagtgatatcctttaaaatcctaacctggagatttatctttg |
112 |
Q |
| |
|
||||||||||||||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
5878972 |
gaagaaaatattatttcaatagaatttgagtgataagaataaaatatgggttgtaagagagtgatatcctttaaaaccctaacctggagatttatctttg |
5878873 |
T |
|
| Q |
113 |
gttgcaaccctttttcatttcctacaaacaatttaattaatttgtgaatctttacacatacaaaaaatgggtatattac |
191 |
Q |
| |
|
||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
5878872 |
gttgcaatcctttttcatttcctacaaacaatttaattaatttgtgaatctttacacatacaaaaaatgggtatattac |
5878794 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 86 - 143
Target Start/End: Complemental strand, 5858855 - 5858798
Alignment:
| Q |
86 |
aaatcctaacctggagatttatctttggttgcaaccctttttcatttcctacaaacaa |
143 |
Q |
| |
|
|||| |||||||||||||||||| |||||| | |||||||||||||||||||||||| |
|
|
| T |
5858855 |
aaattctaacctggagatttatccatggttggacccctttttcatttcctacaaacaa |
5858798 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 68 - 143
Target Start/End: Complemental strand, 5865529 - 5865456
Alignment:
| Q |
68 |
agagagtgatatcctttaaaatcctaacctggagatttatctttggttgcaaccctttttcatttcctacaaacaa |
143 |
Q |
| |
|
||||||||||| |||||| || || ||||||||||||||| |||||| | ||||||||||||||||||||||| |
|
|
| T |
5865529 |
agagagtgata--ctttaagatgctgacctggagatttatccatggttggactcctttttcatttcctacaaacaa |
5865456 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University