View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18738_high_15 (Length: 225)
Name: NF18738_high_15
Description: NF18738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18738_high_15 |
 |  |
|
| [»] scaffold0110 (2 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0110 (Bit Score: 183; Significance: 4e-99; HSPs: 2)
Name: scaffold0110
Description:
Target: scaffold0110; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 15 - 210
Target Start/End: Original strand, 31963 - 32160
Alignment:
| Q |
15 |
aatatggttcttaagtttctaattgtggtagtgaataatgttgtggttttggataaaaaggcctctttttggtctctacaaatgtaatcatgtgacttga |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
31963 |
aatatggttcttaagtttctaattgtggtagtgaataatgttgtggttttggataaaaaggcctctttttggtctctacaaatgtaatcatgcgacttga |
32062 |
T |
 |
| Q |
115 |
ttagtgcaagtcttggaataaagttatcttttaaataaagctagaaacatcatctagtgtcccatgattgaaacacta--acagacaccagacataac |
210 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
32063 |
ttagtgcaagtcttggaataaagttatcttttaaataaagctagaaacatcatctagtgtcccatgattgaaacactaacacagacaccagacataac |
32160 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0110; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 72 - 153
Target Start/End: Original strand, 24167 - 24247
Alignment:
| Q |
72 |
aaggcctctttttggtctctacaaatgtaatcatgtgacttgattagtgcaagtcttggaataaagttatcttttaaataaa |
153 |
Q |
| |
|
|||||||||||||||||||||||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
24167 |
aaggcctctttttggtctctacaa-tgtaatcatgtgacttgattaatgcaagtcttggaataaagttatcttttaaataaa |
24247 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University