View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18738_low_11 (Length: 239)
Name: NF18738_low_11
Description: NF18738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18738_low_11 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 19 - 227
Target Start/End: Original strand, 47430497 - 47430708
Alignment:
| Q |
19 |
ataaagcttgtaaaatggctgtggattgtggaaaaggaaagtgtgtcgttaggtcaaaccacaaacatccatttaagttcgtctgtaaatgtgaacctgg |
118 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47430497 |
ataaagcttgtaaaatggctgtggattgtggaaaaggaaagtgtgtcgttaggtcaaaccacaaacatccatttaagttcgtctgtaaatgtgaacctgg |
47430596 |
T |
 |
| Q |
119 |
ttggaagcaaatcaaagcgggtccaaaacatatgttccttccaaaatcatgtgtcatccctgaatctgaatgtgaatttcactc---tctctctttctta |
215 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| ||||||||||||| |
|
|
| T |
47430597 |
ttggaagcaaatcaaagcgggtccaaaacatatgttccttccaaaagcatgtgtcatccctgaatctgaatgtgaatttcactctgatctctctttctta |
47430696 |
T |
 |
| Q |
216 |
atgtcatatatt |
227 |
Q |
| |
|
|||||||||||| |
|
|
| T |
47430697 |
atgtcatatatt |
47430708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University