View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18738_low_12 (Length: 233)
Name: NF18738_low_12
Description: NF18738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18738_low_12 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 50 - 158
Target Start/End: Complemental strand, 16983109 - 16983001
Alignment:
| Q |
50 |
catccctcgctccaccggatccctctctcccgctgcccccgccgcagaacatttccaccgcaccaccaccactcttcccttcggtaccgattctctcatt |
149 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
16983109 |
catccctcgctccaccggatccctctctcccgctgcccccgccgcagaacaattccaccgcaccaccaccactcttccctacggtaccgattctctcatt |
16983010 |
T |
|
| Q |
150 |
tctccaatt |
158 |
Q |
| |
|
||||||||| |
|
|
| T |
16983009 |
tctccaatt |
16983001 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 102 - 150
Target Start/End: Original strand, 29313504 - 29313552
Alignment:
| Q |
102 |
ttccaccgcaccaccaccactcttcccttcggtaccgattctctcattt |
150 |
Q |
| |
|
|||||||| | ||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
29313504 |
ttccaccgtaacaccatcactcttcccttcagtaccgattctctcattt |
29313552 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University