View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18738_low_12 (Length: 233)

Name: NF18738_low_12
Description: NF18738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18738_low_12
NF18738_low_12
[»] chr4 (1 HSPs)
chr4 (50-158)||(16983001-16983109)
[»] chr8 (1 HSPs)
chr8 (102-150)||(29313504-29313552)


Alignment Details
Target: chr4 (Bit Score: 101; Significance: 3e-50; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 50 - 158
Target Start/End: Complemental strand, 16983109 - 16983001
Alignment:
50 catccctcgctccaccggatccctctctcccgctgcccccgccgcagaacatttccaccgcaccaccaccactcttcccttcggtaccgattctctcatt 149  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||    
16983109 catccctcgctccaccggatccctctctcccgctgcccccgccgcagaacaattccaccgcaccaccaccactcttccctacggtaccgattctctcatt 16983010  T
150 tctccaatt 158  Q
    |||||||||    
16983009 tctccaatt 16983001  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 102 - 150
Target Start/End: Original strand, 29313504 - 29313552
Alignment:
102 ttccaccgcaccaccaccactcttcccttcggtaccgattctctcattt 150  Q
    |||||||| | ||||| ||||||||||||| ||||||||||||||||||    
29313504 ttccaccgtaacaccatcactcttcccttcagtaccgattctctcattt 29313552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University