View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18738_low_13 (Length: 231)

Name: NF18738_low_13
Description: NF18738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18738_low_13
NF18738_low_13
[»] chr4 (1 HSPs)
chr4 (18-213)||(43465910-43466105)


Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 213
Target Start/End: Original strand, 43465910 - 43466105
Alignment:
18 atatcatacctctttggggtcaaaactttgggttaggaacaaaattgccataatgtgtaaaattggagacaacaaacacgaattttaaaatgggaattaa 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43465910 atatcatacctctttggggtcaaaactttgggttaggaacaaaattgccataatgtgtaaaattggagacaacaaacacgaattttaaaatgggaattaa 43466009  T
118 tattgttttaggggcataatttgatgaaatgacaatacgtatctaattaacatgcaatgcatctctctcatactctttctccctccggttgtctca 213  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
43466010 tattgttttaggggcataatttgatgaaatgacaataggtatctaattaacatgcaatgcatctctctcatactctttctccctccggttgtctca 43466105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University