View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18738_low_13 (Length: 231)
Name: NF18738_low_13
Description: NF18738
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18738_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 18 - 213
Target Start/End: Original strand, 43465910 - 43466105
Alignment:
| Q |
18 |
atatcatacctctttggggtcaaaactttgggttaggaacaaaattgccataatgtgtaaaattggagacaacaaacacgaattttaaaatgggaattaa |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43465910 |
atatcatacctctttggggtcaaaactttgggttaggaacaaaattgccataatgtgtaaaattggagacaacaaacacgaattttaaaatgggaattaa |
43466009 |
T |
 |
| Q |
118 |
tattgttttaggggcataatttgatgaaatgacaatacgtatctaattaacatgcaatgcatctctctcatactctttctccctccggttgtctca |
213 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43466010 |
tattgttttaggggcataatttgatgaaatgacaataggtatctaattaacatgcaatgcatctctctcatactctttctccctccggttgtctca |
43466105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University