View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18739_low_4 (Length: 348)
Name: NF18739_low_4
Description: NF18739
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18739_low_4 |
 |  |
|
Alignment Details
Target: chr6 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 20 - 303
Target Start/End: Original strand, 428267 - 428554
Alignment:
| Q |
20 |
gaagcaatagaagaaaattaagaggaacgttgctaaagaattttttgttttcaatctcaattagtgtcaattagtcataacacctagtagccaaaaatag |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
428267 |
gaagcaatagaagaaaattaagaggaacgttgctaaagaattgtttgttttcaatctcaattagtgtcaattagtcataacacctagtagccaaaaatag |
428366 |
T |
 |
| Q |
120 |
catagtttcata----ccacttagaagtaacgtgcataagatccaaatagcatgcaggacaacattgttgatagtggcatagtggtatgcttcatgcagt |
215 |
Q |
| |
|
|||||||||||| ||||||||||||||| ||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| | |
|
|
| T |
428367 |
catagtttcatatataccacttagaagtaacatgcataagatccaaacagcatgcaggacaacattgttgatagtggcatagtggtatgcttcatgcaat |
428466 |
T |
 |
| Q |
216 |
cctcttcaacttcaccttctgcaaacagatgtaagtcattgcaattaaatcaaactcaaacaattgaaacctatagggaattaagaaa |
303 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
428467 |
cctcttcaactttaccttctgcaaacagatgtaagtcattgcaattaaatcaaactcaaacaattgaaacctatagggaattaagaaa |
428554 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University