View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF1873_high_1 (Length: 798)
Name: NF1873_high_1
Description: NF1873
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF1873_high_1 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 379; Significance: 0; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 379; E-Value: 0
Query Start/End: Original strand, 246 - 673
Target Start/End: Complemental strand, 27701740 - 27701313
Alignment:
| Q |
246 |
catgtcttctatgcactgaagacagtagcattttagatgagaatgatcttggtggtccaattgaagatgaaactgagcaatttgatgagccaaatgagta |
345 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
27701740 |
catgtcttctatgcactgaagacagtagcattttagatgagaatgatcttggtggttcaatggaagatgaaactgagcaatttgatgagccaattgagta |
27701641 |
T |
|
| Q |
346 |
tgtgccaccaccattgctgccacctccattgctgagtgaggagaatttgaaggttttgattgaaaaagaatgtcatcacttgcctgctagtgattatgtc |
445 |
Q |
| |
|
|||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27701640 |
tgtgccaccaccattgttgccacctccattgctgagtgaggagaatttgaaggttttgattgaaaaagaatgtcatcacttgcctgctagtgattatgtc |
27701541 |
T |
|
| Q |
446 |
aataggctgaaaaatggtgaattggatttgcagggcaggatggaatccattgattggatggaaaaggtggggtccacatttatttgattcttaatttctc |
545 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27701540 |
aataggctgaaaaatggagaattggatttgcagggcaggatggaatccattgattggatggaaaaggtggggtccacatttatttgattcttaatttctc |
27701441 |
T |
|
| Q |
546 |
attaatttttagggtttcaactatatgtgagttcattttctcttttgctagttccaatgttatgtacattgtttttctttaatctcnnnnnnnattgaca |
645 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| ||||| | |
|
|
| T |
27701440 |
attaatttttagggtttcaactatatgtgagttcattttctcttttgctagttccaatgttatgtgcattgtttttctttaatctctttttttattgaaa |
27701341 |
T |
|
| Q |
646 |
attaatattctttaatcttggcatgtga |
673 |
Q |
| |
|
|||||||||||||||||||||||||||| |
|
|
| T |
27701340 |
attaatattctttaatcttggcatgtga |
27701313 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 9e-23
Query Start/End: Original strand, 50 - 105
Target Start/End: Complemental strand, 27701932 - 27701877
Alignment:
| Q |
50 |
atgaacagcttgaaactatagagtgattttgttcttatttcacaaaggttctttgt |
105 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27701932 |
atgaacagcttgaaactatagagtgattttgttcttatttcacaaaggttctttgt |
27701877 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University