View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18740_high_10 (Length: 301)
Name: NF18740_high_10
Description: NF18740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18740_high_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 227; Significance: 1e-125; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 227; E-Value: 1e-125
Query Start/End: Original strand, 19 - 293
Target Start/End: Original strand, 19095300 - 19095565
Alignment:
| Q |
19 |
atttctatcactttgcatcatgaaaactgcgatgtatcatcatgggttttgcaggaaatggacttacctcacccttgattactctgatttttggaaaaat |
118 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||| ||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19095300 |
atttctatcactttgcatcatgaaaactgcgatgtatcatcattggttatgcaggaaatggacttacctcacccttgattactctgatttttggaaaaat |
19095399 |
T |
 |
| Q |
119 |
ggttaatgcagttggctggagctacaaatcccagagaagcagttcattaagtttccatggtacttatttcactccactactaatctatgtcactttaata |
218 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19095400 |
ggttaatgcagttggctggagctacaaatcccagagaagcagttcattaagtttccatggtacttatttcactccactactaatctatgtcactttaata |
19095499 |
T |
 |
| Q |
219 |
aatatcaaattttgctaatcattttgataatcattttgtttgcaacttaggtagccctgaattcctatattcttc |
293 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
19095500 |
aatatcaaattt---------atttgataatcattttgtttgcaacttaggtagccctgaattcctattttcttc |
19095565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University