View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18740_high_17 (Length: 230)

Name: NF18740_high_17
Description: NF18740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18740_high_17
NF18740_high_17
[»] chr4 (1 HSPs)
chr4 (18-95)||(46551487-46551564)


Alignment Details
Target: chr4 (Bit Score: 70; Significance: 1e-31; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 18 - 95
Target Start/End: Complemental strand, 46551564 - 46551487
Alignment:
18 tactatgtgagatgttccgactacttgtcttaaaaccttgacttgaaatcagtgttgtcaaaaggaaaacacaattaa 95  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||    
46551564 tactatgtgagatgttctgactacttgtcttaaaaccttgacttgaaaccagtgttgtcaaaaggaaaacacaattaa 46551487  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University