View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18740_low_11 (Length: 256)
Name: NF18740_low_11
Description: NF18740
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18740_low_11 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 91; Significance: 3e-44; HSPs: 2)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 91; E-Value: 3e-44
Query Start/End: Original strand, 117 - 240
Target Start/End: Original strand, 32598146 - 32598273
Alignment:
| Q |
117 |
gctaccatcttttttatc----tatcatttttgtgttataaatctataaaaattttaattctaaagctatatgtatattctgttcaattgcaaccatact |
212 |
Q |
| |
|
|||||||||||||||||| |||||||||||| ||| ||||||||||| |||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
32598146 |
gctaccatcttttttatctatctatcatttttgtcttacaaatctataaatattttaattctaaagctatatgtatattttgttcaattgcaaccatact |
32598245 |
T |
 |
| Q |
213 |
aatgacaagaacatatgtccaaaattat |
240 |
Q |
| |
|
||||| |||||||||||||||||||||| |
|
|
| T |
32598246 |
aatgataagaacatatgtccaaaattat |
32598273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 54; E-Value: 4e-22
Query Start/End: Original strand, 13 - 66
Target Start/End: Original strand, 32598091 - 32598144
Alignment:
| Q |
13 |
aatattctcaagtatatagttagaaggacgatagtactatgccgccaccacatc |
66 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32598091 |
aatattctcaagtatatagttagaaggacgatagtactatgccgccaccacatc |
32598144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University