View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18741_high_6 (Length: 319)
Name: NF18741_high_6
Description: NF18741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18741_high_6 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 305; Significance: 1e-172; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 305; E-Value: 1e-172
Query Start/End: Original strand, 8 - 316
Target Start/End: Complemental strand, 22155315 - 22155007
Alignment:
| Q |
8 |
gacatcatcatctctccttgcccaatccatgtcagaactgtccctatctttttgcctatcaaatccgtcagtatttgtatgcaattgatgggccaagcta |
107 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22155315 |
gacatcatcatctctccttgcccaatccatgtcagaactgtccctatctttttgcctatcaaatccgtcagtatttgtatgcaattgatgggccaagcta |
22155216 |
T |
 |
| Q |
108 |
cgatgccggtccttgtaagggtatgatccatctctacctctaagtaccatgtgatttctttcgggatcttgctttccatcatgctcttttctatagaatc |
207 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22155215 |
cgatgccggtccttgtaagggtatgatccctctctacctctaagtaccatgtgatttctttcgggatcttgctttccatcatgctcttttctatagaatc |
22155116 |
T |
 |
| Q |
208 |
cctgctcattttcatcagggtgttgtctgatgctagccagacgtgttgatcgtggatcctggactacttcttcatcaagaccctctcgtcgcttctgatt |
307 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
22155115 |
cctgctcattttcatcagggtgttgtctgatgctagccagacgtgttgatcgtggatcctggactacttcttcatcaagaccctctcgtcgcttctgatt |
22155016 |
T |
 |
| Q |
308 |
atctctgct |
316 |
Q |
| |
|
||||||||| |
|
|
| T |
22155015 |
atctctgct |
22155007 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University