View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18741_low_11 (Length: 295)
Name: NF18741_low_11
Description: NF18741
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18741_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 262; Significance: 1e-146; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 262; E-Value: 1e-146
Query Start/End: Original strand, 1 - 286
Target Start/End: Original strand, 42444719 - 42445004
Alignment:
| Q |
1 |
cgtcaaaccacacataccccagatttcttggggttgcagcaaaatatcggattatggaaggaatcaaattttggaaagggaattattattggtgttctag |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42444719 |
cgtcaaaccacacataccccagatttcttggggttgcagcaaaatatcggatcttggaaggaatcaaattttggaaagggaattattattggtgttctag |
42444818 |
T |
|
| Q |
101 |
attcaggaatcacacctgatgatcatccttcgtgtagtgacgcaggaataccaccaccaccgtcgaaatggaaagggagatgcgaacttaatggtacagt |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| |
|
|
| T |
42444819 |
attcaggaatcacacctgatgatcatccttcgtttagtgacgcaggaataccaccaccaccgtcgaaatggaaagggagatgcaaacttaatggtacagt |
42444918 |
T |
|
| Q |
201 |
ttgtaacaacaaattaattggagcaagatccttcaacaatgcagcagtaaaaggagagaaagctgaagcacgaattgatgatgatg |
286 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||| |
|
|
| T |
42444919 |
ttgtaacaacaaattaattggagcaagatccttcaacaatgcagcagtaaaaggagagaaagctgaagcaccaattgatgaggatg |
42445004 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University