View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18742_high_13 (Length: 238)
Name: NF18742_high_13
Description: NF18742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18742_high_13 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 1 - 222
Target Start/End: Original strand, 8172627 - 8172848
Alignment:
| Q |
1 |
gtatggtcatggatcaatccttttttaggatgactatcaatgaagcatttaattgttttcagatgcttgagattaactttatttggaaattcattttaaa |
100 |
Q |
| |
|
||||||||||||||||| |||||||||| |||||||||||||||||||||||| ||||| ||| | |||||||| ||||||||||||||||||||||||| |
|
|
| T |
8172627 |
gtatggtcatggatcaaaccttttttagaatgactatcaatgaagcatttaatcgttttgagaagtttgagattgactttatttggaaattcattttaaa |
8172726 |
T |
|
| Q |
101 |
ttttctcttgatttggtgtaatcacgctttcatttaaatagttgagttttttaactttttgatcttatgatacacttagccagctaagtgatcgataaat |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
8172727 |
ttttctcttgatttggtgtaatcgcgctttcatttaaatagttgagttttgtaactttttgatcttatgatacacctagccagctaagtgatcgataaat |
8172826 |
T |
|
| Q |
201 |
tgcactcttcgagtgagtgtag |
222 |
Q |
| |
|
|||||||||||||||||||||| |
|
|
| T |
8172827 |
tgcactcttcgagtgagtgtag |
8172848 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University