View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18742_high_15 (Length: 227)
Name: NF18742_high_15
Description: NF18742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18742_high_15 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 131; Significance: 4e-68; HSPs: 3)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 1 - 154
Target Start/End: Original strand, 37217456 - 37217607
Alignment:
| Q |
1 |
tagtaaggacaagtttgcaatttacattttgctgcaatgtttcttgtaattcactaggatcccgcctatgaagctctcacacacagtaaaacaagcagta |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||| |
|
|
| T |
37217456 |
tagtaaggacaagtttgcaatttacattttgctgcaatgtttcttgtaattcactaggatcccgcctatgaagcact--cacacagtaaaacaagcagta |
37217553 |
T |
 |
| Q |
101 |
aaagatgatgaagaacttaatgatgacttgtatgaaaataactttttagtagtt |
154 |
Q |
| |
|
||||||||||||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
37217554 |
aaagatgatgaagaacttaatgatgacttatatgaaaataacttttcagtagtt |
37217607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 37217606 - 37217655
Alignment:
| Q |
178 |
tttaggcaaagcatgggatagttttttccttaaaaatgtgaagcagaagc |
227 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37217606 |
tttaggcaaagcatgggatagttttttccttaaaaatgtgaagcagaagc |
37217655 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 123 - 223
Target Start/End: Original strand, 37203864 - 37203966
Alignment:
| Q |
123 |
atgacttgtatgaaaataacttttt---agtagttggaccaaagctttcattacagaatttaggcaaagcatgggatagttttttccttaaaaatgtgaa |
219 |
Q |
| |
|
||||||| ||||||||||||| || ||| ||||||||||| ||| | ||| ||||||| ||||||||||||||| ||| || |||||||| ||||| |
|
|
| T |
37203864 |
atgacttacatgaaaataacttcttctcagttgttggaccaaatcttcccttaaagaattttggcaaagcatgggatggttgatt-cttaaaaaggtgaa |
37203962 |
T |
 |
| Q |
220 |
gcag |
223 |
Q |
| |
|
|||| |
|
|
| T |
37203963 |
gcag |
37203966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University