View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18742_low_19 (Length: 227)

Name: NF18742_low_19
Description: NF18742
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18742_low_19
NF18742_low_19
[»] chr1 (3 HSPs)
chr1 (1-154)||(37217456-37217607)
chr1 (178-227)||(37217606-37217655)
chr1 (123-223)||(37203864-37203966)


Alignment Details
Target: chr1 (Bit Score: 131; Significance: 4e-68; HSPs: 3)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 131; E-Value: 4e-68
Query Start/End: Original strand, 1 - 154
Target Start/End: Original strand, 37217456 - 37217607
Alignment:
1 tagtaaggacaagtttgcaatttacattttgctgcaatgtttcttgtaattcactaggatcccgcctatgaagctctcacacacagtaaaacaagcagta 100  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||  |||||||||||||||||||||    
37217456 tagtaaggacaagtttgcaatttacattttgctgcaatgtttcttgtaattcactaggatcccgcctatgaagcact--cacacagtaaaacaagcagta 37217553  T
101 aaagatgatgaagaacttaatgatgacttgtatgaaaataactttttagtagtt 154  Q
    ||||||||||||||||||||||||||||| |||||||||||||||| |||||||    
37217554 aaagatgatgaagaacttaatgatgacttatatgaaaataacttttcagtagtt 37217607  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 50; E-Value: 9e-20
Query Start/End: Original strand, 178 - 227
Target Start/End: Original strand, 37217606 - 37217655
Alignment:
178 tttaggcaaagcatgggatagttttttccttaaaaatgtgaagcagaagc 227  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||    
37217606 tttaggcaaagcatgggatagttttttccttaaaaatgtgaagcagaagc 37217655  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #3
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 123 - 223
Target Start/End: Original strand, 37203864 - 37203966
Alignment:
123 atgacttgtatgaaaataacttttt---agtagttggaccaaagctttcattacagaatttaggcaaagcatgggatagttttttccttaaaaatgtgaa 219  Q
    |||||||  ||||||||||||| ||   ||| ||||||||||| ||| | ||| ||||||| ||||||||||||||| |||  || |||||||| |||||    
37203864 atgacttacatgaaaataacttcttctcagttgttggaccaaatcttcccttaaagaattttggcaaagcatgggatggttgatt-cttaaaaaggtgaa 37203962  T
220 gcag 223  Q
    ||||    
37203963 gcag 37203966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University