View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18743_high_28 (Length: 314)
Name: NF18743_high_28
Description: NF18743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18743_high_28 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 251; Significance: 1e-139; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 251; E-Value: 1e-139
Query Start/End: Original strand, 1 - 300
Target Start/End: Complemental strand, 42246892 - 42246594
Alignment:
| Q |
1 |
tcattcttttctaaatttgcagcagcagcaaaaagaggatgttggtggatttaaaactagaaagggtgttannnnnnngatagaagttgaggtgagtgca |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
42246892 |
tcattcttttctaaatttgcagcagcagcaaaaagaggatgttggtggatttaaaa-tagaaagggtgttatttttttgatagatgttgaggtgagtgca |
42246794 |
T |
 |
| Q |
101 |
gtctgttaaatttatatcatcgtaactgtgtctctttggataggttatttattggcattgcaatatagtacatttgttgtgaaagggtgtagttgaagtt |
200 |
Q |
| |
|
||||||||||||| |||||||||| ||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42246793 |
gtctgttaaatttgtatcatcgtagctgtgtctctttggataggttatttatgggcattgcaatatagtacatttgttgtgaaagggtgtagttgaagtt |
42246694 |
T |
 |
| Q |
201 |
gtagaacgcatttcttcctatagtggtaaacactaaatttcatggtttatagcatgccataggattactttcagttttaaagtgtgttgcccctgatgat |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
42246693 |
gtagaacgcatttcttcctatagtggtaaacactaaatttcatggtttatagcatgccataggattactttcagttttaaagtgtgttgccccttatgat |
42246594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University