View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18743_high_43 (Length: 239)
Name: NF18743_high_43
Description: NF18743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18743_high_43 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 185; Significance: 1e-100; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 185; E-Value: 1e-100
Query Start/End: Original strand, 1 - 222
Target Start/End: Complemental strand, 8092200 - 8091977
Alignment:
| Q |
1 |
acattttataataaaacgacggcctaaaatttaaatagagctatatatcaatacttaccaatcatagataaaagcaagggctcgatatgctgcttctatg |
100 |
Q |
| |
|
|||||||||||||||||||| || |||||||| |||| ||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8092200 |
acattttataataaaacgacagcttaaaatttgaatacagctatatatcaacacttaccaatcatagataaaagcaagggctcgatatgctgcttctatg |
8092101 |
T |
 |
| Q |
101 |
tctgtttttgattgggatattggcacaaaccatggagcatttagtgatatcccaatttgacccttttgtgaaatctgttagaaaatttcattgtcaataa |
200 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
8092100 |
tctgtttttgattgggatagtggcacaaaccatggagcatttagtgatatcccaatttgaccattttgtgaaatctgttagaaaatttcattgtcaataa |
8092001 |
T |
 |
| Q |
201 |
attttgta--gtgatatcactatt |
222 |
Q |
| |
|
|||||||| |||||||||||||| |
|
|
| T |
8092000 |
attttgtagtgtgatatcactatt |
8091977 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 123 - 169
Target Start/End: Complemental strand, 8114181 - 8114135
Alignment:
| Q |
123 |
gcacaaaccatggagcatttagtgatatcccaatttgacccttttgt |
169 |
Q |
| |
|
|||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
8114181 |
gcacaaaccagggagcattccctgatatcccaatttgacccttttgt |
8114135 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 53 - 168
Target Start/End: Complemental strand, 7730903 - 7730788
Alignment:
| Q |
53 |
acttaccaatcatagataaaagcaagggctcgatatgctgcttctatgtctgtttttgattgggatattggcacaaaccatggagcatttagtgatatcc |
152 |
Q |
| |
|
|||||||| ||||| ||||||||||| | ||| | | ||||||| |||| |||||||||||||| |||||||| ||||| || |||||||| || || |
|
|
| T |
7730903 |
acttaccagtcatacataaaagcaagaccccgagacgttgcttctctgtcctcttttgattgggatagtggcacaagccatgcagaatttagtgttaccc |
7730804 |
T |
 |
| Q |
153 |
caatttgacccttttg |
168 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
7730803 |
caatttgacccttttg |
7730788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University