View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18743_high_45 (Length: 238)
Name: NF18743_high_45
Description: NF18743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18743_high_45 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 200; Significance: 1e-109; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 200; E-Value: 1e-109
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 41077234 - 41077462
Alignment:
| Q |
1 |
ccaatattttgtaatgtcctggaaattaaagtcacagttggcagtggatggtttgattgagagttgcaatgtctcgatctttgatagaaagagcgatgtt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41077234 |
ccaatattttgtaatgtcctggaaattaaagtcacagttggcagtggatggtttgattgagagttgcaatgtctcgatctttgatagaaagagcgatgtt |
41077333 |
T |
|
| Q |
101 |
gagtatgaca--------gcccttatgacttccctacagttctttagggacatcaaatgagtccgagatagatttgcatatttgacctcaatgggcttcc |
192 |
Q |
| |
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41077334 |
gagtatgacattttgagagcccttatgacttccctacagttctttagggacatcaaatgagtccgagatagatttgcatatttgacctcaatgggcttcc |
41077433 |
T |
|
| Q |
193 |
atatttggcaggctgtgtcgcaggaggag |
221 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
41077434 |
atatttggcaggctgtgtcgcaggaggag |
41077462 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 131 - 184
Target Start/End: Complemental strand, 50191530 - 50191477
Alignment:
| Q |
131 |
gttctttagggacatcaaatgagtccgagatagatttgcatatttgacctcaat |
184 |
Q |
| |
|
|||||| |||||||||| |||||||||| || |||||||||||||| ||||||| |
|
|
| T |
50191530 |
gttcttcagggacatcacatgagtccgatatggatttgcatatttggcctcaat |
50191477 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University