View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18743_low_16 (Length: 439)
Name: NF18743_low_16
Description: NF18743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18743_low_16 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 215; Significance: 1e-118; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 215; E-Value: 1e-118
Query Start/End: Original strand, 203 - 421
Target Start/End: Original strand, 30645106 - 30645324
Alignment:
| Q |
203 |
ttacctcccaacaccaaagacatgaatcagaatgatcttccaaaatatcagcatcagcattgggaactccgtacatcatcctttgcccaacaaacaacac |
302 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30645106 |
ttacctcccaacaccaaagacatgaatcagaatgatcttccaaaatatcagcatcagcattgggaactccgtacatcatcctttgcccaacaaacaacac |
30645205 |
T |
|
| Q |
303 |
actacttttcaccaaagcagaattaaccccttccgccaacacaattcccgcattcgccacttcacaattcaccttctcataaatctcatcaacaagctta |
402 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30645206 |
actacttttcaccaaagcagaattaaccccttccgccaacacaatacccgcattcgccacttcacaattcaccttctcataaatctcatcaacaagctta |
30645305 |
T |
|
| Q |
403 |
gacaacggaagctcactct |
421 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
30645306 |
gacaacggaagctcactct |
30645324 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 103; E-Value: 4e-51
Query Start/End: Original strand, 14 - 124
Target Start/End: Original strand, 30644917 - 30645027
Alignment:
| Q |
14 |
catcagcagcaagcaaacagtgtaaccaatacacattcaacttcgacacagacccaattattatcaacatccaaaaaactttgatttacacagatttaag |
113 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||| |
|
|
| T |
30644917 |
catcagcagcaagcaaacagtgtaaccaatacacattcaacttcaacacagacccaattattatcaacatccaaaaaacattgatttacacagatttaag |
30645016 |
T |
|
| Q |
114 |
ataacccggtt |
124 |
Q |
| |
|
||||||||||| |
|
|
| T |
30645017 |
ataacccggtt |
30645027 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University