View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18743_low_18 (Length: 431)
Name: NF18743_low_18
Description: NF18743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18743_low_18 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 250; Significance: 1e-139; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 250; E-Value: 1e-139
Query Start/End: Original strand, 142 - 417
Target Start/End: Complemental strand, 41077059 - 41076785
Alignment:
| Q |
142 |
tttttctttattctatatcctaacaggtctggactctgttaccattgaagacggctccggtttagtcagaacagaacgcactggttccactcacctctgt |
241 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41077059 |
tttttctttattctatatcctaacaggtctggactctgttaccattgaagacggctccggtttagtcagaacagaacgcactggttccactcacctctgt |
41076960 |
T |
|
| Q |
242 |
accccatatacttatctcgctgttaataatgctttgtgtatccaaagcaagccataacttaatctcaaattttggtagcagaatattgtgtgttgaattt |
341 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41076959 |
accccatatacttatctcgctgttaataatgctttgtgtatccaaagcaagccataacttaatctcaaattttggtagcagaatattgtgtgttgaattt |
41076860 |
T |
|
| Q |
342 |
cacccattttcttttctgagaatgatctcaaaacnnnnnnncaatgttgatgcacggtccaagtaatggtaacctt |
417 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
41076859 |
cacccattttcttttctgagaatgatctcaaaac-ggggggcaatgttgatgcacggtccaagtaatggtaacctt |
41076785 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 56; E-Value: 5e-23
Query Start/End: Original strand, 1 - 64
Target Start/End: Complemental strand, 41077200 - 41077137
Alignment:
| Q |
1 |
tttaagtcttcactttgactatgaaggtcttgttaggattatagaataacgggacaaaggatca |
64 |
Q |
| |
|
||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
41077200 |
tttaagtcttccctttgactatgaaggtcttgttaggattatagaataacgggataaaggatca |
41077137 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University