View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18743_low_35 (Length: 280)
Name: NF18743_low_35
Description: NF18743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18743_low_35 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 112; Significance: 1e-56; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 112; E-Value: 1e-56
Query Start/End: Original strand, 1 - 116
Target Start/End: Complemental strand, 21576202 - 21576087
Alignment:
| Q |
1 |
aacacagacacaatgtggtgactgatacatatacgttgattttatataaagtttgtatcttttgattgaatcattttgagggttttgtttatttcagcat |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
21576202 |
aacacagacacaatgtggtgactgatacatatatgttgattttatataaagtttgtatcttttgattgaatcattttgagggttttgtttatttcagcat |
21576103 |
T |
|
| Q |
101 |
atttatgagattatgg |
116 |
Q |
| |
|
|||||||||||||||| |
|
|
| T |
21576102 |
atttatgagattatgg |
21576087 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 103; E-Value: 3e-51
Query Start/End: Original strand, 156 - 270
Target Start/End: Complemental strand, 21576060 - 21575946
Alignment:
| Q |
156 |
gggttgattcaggaagaagggtggccatttggattgagattattgaattctagagttggggtgatgagaaatggtgatttttcaggttcagtctccttta |
255 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
21576060 |
gggttgattcaggaagaagggtggccatttggattgagattattgaattctagagttggggtgatgagaaatggtgatttttcaggttcagtttccttta |
21575961 |
T |
|
| Q |
256 |
gcactttgctctctg |
270 |
Q |
| |
|
| |||||||| |||| |
|
|
| T |
21575960 |
gtactttgctttctg |
21575946 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University