View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18743_low_38 (Length: 261)
Name: NF18743_low_38
Description: NF18743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18743_low_38 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 2)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 100 - 246
Target Start/End: Complemental strand, 52593420 - 52593274
Alignment:
| Q |
100 |
aatcatgaggcagtagtatgtctctctttattttgtcctttttaaaaaagtctgtgatcatgaaatgattatgatggggtagtagtatattatttgtgcg |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
52593420 |
aatcatgaggcagtagtatgtctctctttattttgtcctttttaaaaaagtctgtgatcatgaaatgattatgatggggtagtagtatattgtttgtgcg |
52593321 |
T |
|
| Q |
200 |
tgatagaaggtaatctctttgtaataataatacatgagtgatatgat |
246 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52593320 |
tgatagaaggtaatctctttgtaataataatacatgagtgatatgat |
52593274 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 41
Target Start/End: Complemental strand, 52593503 - 52593472
Alignment:
| Q |
10 |
ataattctctattgcacctctgcttgctctgg |
41 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
52593503 |
ataattctctattgcacctctgcttgctctgg |
52593472 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University