View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18743_low_46 (Length: 245)
Name: NF18743_low_46
Description: NF18743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18743_low_46 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 89; Significance: 5e-43; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 26 - 153
Target Start/End: Original strand, 39426413 - 39426540
Alignment:
| Q |
26 |
acaagatcatcaaaatcaccaaacacaaagtcatt-aagtataaccctcttttaattgacacactaaataagatttacccaattaatttgtgcttgacca |
124 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||| |||||||||||| | |||||||||||||||||||||||||||||||||| |
|
|
| T |
39426413 |
acaagatcatcaaaatcaccaaacacaaagtcattgaagtataaccctgttttaattgacagtgtgaataagatttacccaattaatttgtgcttgacca |
39426512 |
T |
 |
| Q |
125 |
ggtcaaatcacacaaactcacattacctt |
153 |
Q |
| |
|
|||||||||||| ||||||||||||||| |
|
|
| T |
39426513 |
tgtcaaatcacac-aactcacattacctt |
39426540 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University