View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18743_low_48 (Length: 239)
Name: NF18743_low_48
Description: NF18743
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18743_low_48 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 173; Significance: 4e-93; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 173; E-Value: 4e-93
Query Start/End: Original strand, 1 - 221
Target Start/End: Complemental strand, 7220938 - 7220718
Alignment:
| Q |
1 |
ccggtatagatagcagccattagccagcccaaccattgacccaacgcactgtgtgttacatgttcctgtgatgaaatctagttagtagcagtaagcaaat |
100 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
7220938 |
ccggtatagatagcagccatgagccatcccaaccattgacccaatgcactgtgtgttacatgttcctgtgatgagttctagttagtagcagtaagcaaat |
7220839 |
T |
|
| Q |
101 |
gaaattatgcaaattgaaagtaagtaaccaaacaccgaggaaattattataggactaggagtgtgtgaatcacatacctgggagagtagttttcttccac |
200 |
Q |
| |
|
| ||||||||||||||||||||||||| ||||||| |||||||| |||||| || ||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
7220838 |
gcaattatgcaaattgaaagtaagtaatcaaacactgaggaaatgattatacgattaggagtgtgtgaataacatacctgggagagtagttttcttccac |
7220739 |
T |
|
| Q |
201 |
ttagtgctatgtatccgactt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
7220738 |
ttagtgctatgtatccgactt |
7220718 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University