View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18744_high_3 (Length: 326)
Name: NF18744_high_3
Description: NF18744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18744_high_3 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 295; Significance: 1e-166; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 295; E-Value: 1e-166
Query Start/End: Original strand, 13 - 311
Target Start/End: Complemental strand, 43107901 - 43107603
Alignment:
| Q |
13 |
tcatcatgatgaaggatcaacaagttcaaaaattcacaagtgtgaattatgtaacaaaatttttaggtgtggaaaaggattaggtggtcacaaaagaatc |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43107901 |
tcatcatgatgaaggatcaacaagttcaaaaattcacaagtgtgaattatgtaacaaaatttttaggtgtggaaaaggattaggtggtcacaaaagaatc |
43107802 |
T |
 |
| Q |
113 |
catagtcaagccctagggaaagagggtgagtcgaaagcaaaggctaattgcaattctaatgatgtaaaattaagttgtgatgtttgcaaaaagaacttcc |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43107801 |
catagtcaagccctagggaaagagggtgagtcgaaagcagaggctaattgcaattctaatgatgtaaaattaagttgtgatgtttgcaaaaagaacttcc |
43107702 |
T |
 |
| Q |
213 |
aatccaataaggctttacatggtcacatgagatctcatcctgaaagggaatggcggggtatgaaccctaataaggataataatattgattatcatgatt |
311 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
43107701 |
aatccaataaggctttacatggtcacatgagatctcatcctgaaagggaatggcggggtatgaaccctaataaggataataatattgattatcatgatt |
43107603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University