View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF18744_high_8 (Length: 251)

Name: NF18744_high_8
Description: NF18744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF18744_high_8
NF18744_high_8
[»] chr7 (1 HSPs)
chr7 (19-233)||(30076286-30076500)


Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 19 - 233
Target Start/End: Original strand, 30076286 - 30076500
Alignment:
19 cataggacacaaaagaggcttagtctcgggtggatgagtttatcatgtctctcattataaatgagtgagnnnnnnnccatgcgatataatattaaaataa 118  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| ||||||||       |||||||||||||||||||| |||    
30076286 cataggacacaaaagaggcttagtctccggtggatgagtttatcatgtctctcactataagtgagtgagtttttttccatgcgatataatattaaagtaa 30076385  T
119 tggacaaccaagatcatcgaacggtaactcattgctacagtgcttacggtgagagaaataataaacttatccaccggagactatgcccatcatgaattaa 218  Q
    ||||||||||||||| | ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
30076386 tggacaaccaagatcgttgaacggtaactcattgctacagtgcttacggtgagagaaataataaacttatccaccggagactatgcccatcatgaattaa 30076485  T
219 tgtagtgggaaatct 233  Q
    |||||||||||||||    
30076486 tgtagtgggaaatct 30076500  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University