View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18744_low_9 (Length: 251)
Name: NF18744_low_9
Description: NF18744
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18744_low_9 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 170; Significance: 2e-91; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 170; E-Value: 2e-91
Query Start/End: Original strand, 19 - 233
Target Start/End: Original strand, 30076286 - 30076500
Alignment:
| Q |
19 |
cataggacacaaaagaggcttagtctcgggtggatgagtttatcatgtctctcattataaatgagtgagnnnnnnnccatgcgatataatattaaaataa |
118 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||| |||||||| |||||||||||||||||||| ||| |
|
|
| T |
30076286 |
cataggacacaaaagaggcttagtctccggtggatgagtttatcatgtctctcactataagtgagtgagtttttttccatgcgatataatattaaagtaa |
30076385 |
T |
 |
| Q |
119 |
tggacaaccaagatcatcgaacggtaactcattgctacagtgcttacggtgagagaaataataaacttatccaccggagactatgcccatcatgaattaa |
218 |
Q |
| |
|
||||||||||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30076386 |
tggacaaccaagatcgttgaacggtaactcattgctacagtgcttacggtgagagaaataataaacttatccaccggagactatgcccatcatgaattaa |
30076485 |
T |
 |
| Q |
219 |
tgtagtgggaaatct |
233 |
Q |
| |
|
||||||||||||||| |
|
|
| T |
30076486 |
tgtagtgggaaatct |
30076500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University