View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18745_low_10 (Length: 237)
Name: NF18745_low_10
Description: NF18745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18745_low_10 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 202; Significance: 1e-110; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 202; E-Value: 1e-110
Query Start/End: Original strand, 2 - 231
Target Start/End: Original strand, 10230886 - 10231115
Alignment:
| Q |
2 |
tgaagcatgccgtcaccgtcgaagaggtggtagggtccacgtggaaggaactgtgggtttggtccgtttcttatgtaagcaccgttaagtgacggcggga |
101 |
Q |
| |
|
|||||||||||||||||||| ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
10230886 |
tgaagcatgccgtcaccgtcaaagagatggtagggtccacgtggaaggaactgtgggtttggtccgtttcttatgtaagcaccgtaaagtgacggcggga |
10230985 |
T |
|
| Q |
102 |
gtgtacctttgatgatttgacattgtgttggagggagttcgtcaaggactggtgcaaagttttgggacaaaacatgtcttggatctacggatggttttat |
201 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10230986 |
gtgtacctttgatgattacacattgtgttggagggagttcgtctaggactggtgcaaagttttgggacaaaacatgtcttggatctacggatggttttat |
10231085 |
T |
|
| Q |
202 |
tggtgggtctatgaaggtgttgatgatgtc |
231 |
Q |
| |
|
|||||||||||||||||||||||| ||||| |
|
|
| T |
10231086 |
tggtgggtctatgaaggtgttgataatgtc |
10231115 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 1 - 231
Target Start/End: Complemental strand, 10254940 - 10254710
Alignment:
| Q |
1 |
gtgaagcatgccgtcaccgtcgaagaggtggtagggtccacgtggaaggaactgtgggtttggtccgtttcttatgtaagcaccgttaagtgacggcggg |
100 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||| || |
|
|
| T |
10254940 |
gtgaagcatgccatcaccgtcgaagaggtggtagggtccacgtggaaggaactgtgggtttggtccgtttcttatgtaaacaccgttaagtgacggtgga |
10254841 |
T |
|
| Q |
101 |
agtgtacctttgatgatttgacattgtgttggagggagttcgtcaaggactggtgcaaagttttgggacaaaacatgtcttggatctacggatggtttta |
200 |
Q |
| |
|
||||| ||||| |||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10254840 |
agtgtgcctttaatgactttgcattgtgttggagggagttcgtcaaggactggtgcaaagttttgggacaaaacatgtcttggatctacggatggtttta |
10254741 |
T |
|
| Q |
201 |
ttggtgggtctatgaaggtgttgatgatgtc |
231 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
10254740 |
ttggtgggtctatgaaggtgttgatgatgtc |
10254710 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 2 - 231
Target Start/End: Original strand, 10239666 - 10239895
Alignment:
| Q |
2 |
tgaagcatgccgtcaccgtcgaagaggtggtagggtccacgtggaaggaactgtgggtttggtccgtttcttatgtaagcaccgttaagtgacggcggga |
101 |
Q |
| |
|
|||||||||||||||||||| ||||| ||||| |||||||||||||||||||| |||||||||||||||||||||||| |||||||||||||||| || | |
|
|
| T |
10239666 |
tgaagcatgccgtcaccgtcaaagagatggtaaggtccacgtggaaggaactgagggtttggtccgtttcttatgtaaacaccgttaagtgacggtggaa |
10239765 |
T |
|
| Q |
102 |
gtgtacctttgatgatttgacattgtgttggagggagttcgtcaaggactggtgcaaagttttgggacaaaacatgtcttggatctacggatggttttat |
201 |
Q |
| |
|
|||| ||||| |||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10239766 |
gtgtgcctttaatgactttgcattgtgttggagggagttcgtcaaggactggtgcaaagttttgggacaaaacatgtcttggatctacggatggttttat |
10239865 |
T |
|
| Q |
202 |
tggtgggtctatgaaggtgttgatgatgtc |
231 |
Q |
| |
|
|||||||||||||||||||||||||||||| |
|
|
| T |
10239866 |
tggtgggtctatgaaggtgttgatgatgtc |
10239895 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University