View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18745_low_13 (Length: 205)
Name: NF18745_low_13
Description: NF18745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18745_low_13 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 132; Significance: 9e-69; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 132; E-Value: 9e-69
Query Start/End: Original strand, 1 - 148
Target Start/End: Original strand, 48005698 - 48005845
Alignment:
| Q |
1 |
ttgttcaaattccactacgctataacattacagccaccacgaatctctcaaaccacaaaccctagtcacttatatcaaatcgctgatgagaacaaaactc |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||| |
|
|
| T |
48005698 |
ttgttcaaattccactacgctataacattacagccaccatgaatctctcaaaccacaaaccctagtcacttatatcaaatcgttgatgagaacagaactc |
48005797 |
T |
 |
| Q |
101 |
attcattaatctagggttttagaactcacaactacacagaaacaagtg |
148 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
| T |
48005798 |
attcattaatctagggttttagaactcaaaactacacagaaacaagtg |
48005845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 44; E-Value: 3e-16
Query Start/End: Original strand, 147 - 190
Target Start/End: Original strand, 48005867 - 48005910
Alignment:
| Q |
147 |
tggacaattgtgagaaaggaactgtaccgctatgaggaggtaag |
190 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48005867 |
tggacaattgtgagaaaggaactgtaccgctatgaggaggtaag |
48005910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University