View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18745_low_8 (Length: 253)
Name: NF18745_low_8
Description: NF18745
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18745_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 14 - 208
Target Start/End: Original strand, 6958597 - 6958794
Alignment:
| Q |
14 |
caaaggcaaaatgaactaagcttaattgatcggtcg---tcccttaacttaattgattgtttcaaaatggttccattattaaaaaatgtcttaaagtagt |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
6958597 |
caaaggcaaaatgaactaagcttaattgatcggtcgtcgtcccttaacttaattgattgtttcaaaatggttctattattaaaaaatgtcttaaagtagt |
6958696 |
T |
 |
| Q |
111 |
cccttaaattgtaagttgttatagattttggtatcttccatgagtatttaaccctaaatgtctaaagtttttgtcctttctatcagtttttaaccttc |
208 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||| |
|
|
| T |
6958697 |
cccttaaattgtaagttgttatagattttggtatcttccatgagtatttaaccctaaatgtctaaagtttttgtcttttctatcagtttttaaccttc |
6958794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 33 - 120
Target Start/End: Original strand, 8661679 - 8661767
Alignment:
| Q |
33 |
gcttaattgatcggtcg-tcccttaacttaattgattgtttcaaaatggttccattattaaaaaatgtcttaaagtagtcccttaaatt |
120 |
Q |
| |
|
|||||||||||| | || ||||||||||||||| ||||| || |||||| |||| | ||||||| |||| ||||| |||||||||||| |
|
|
| T |
8661679 |
gcttaattgatcagccggtcccttaacttaattctttgttccagaatggtcccataactaaaaaacgtctcaaagtggtcccttaaatt |
8661767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University