View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18747_high_31 (Length: 290)
Name: NF18747_high_31
Description: NF18747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18747_high_31 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 218; Significance: 1e-120; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 218; E-Value: 1e-120
Query Start/End: Original strand, 1 - 275
Target Start/End: Complemental strand, 14613083 - 14612808
Alignment:
| Q |
1 |
gacacgccttcaatcagaagtgtcgctgcaacagttttcctctaaccaagaattatgagtaagggtaaatctcttattaacatcttccattttcctgtca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14613083 |
gacacgccttcaatcagaagtgtcgctgcaacagttttcctctaaccaagaattatgagtacgggtaaatctcttattaacatcttccattttcctgtca |
14612984 |
T |
 |
| Q |
101 |
annnnnnnctttctcgtacatattttatattgcaagctagttgaatgacaaattatacaccttgnnnnnnncatagcacatact-gggaccatattgcaa |
199 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||||| |
|
|
| T |
14612983 |
atttttttctttctcgtacatattttatattgcaagctagttgaatgacaaattatacaccttgaaaaaaacatagcacatactggggaccatattgcaa |
14612884 |
T |
 |
| Q |
200 |
aataattaggatggatttgttattcattctaatgtattgtttacagtaggctaatatactgcacatgtttcattgt |
275 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
14612883 |
aataattaggatggatttgttattcattctaatgtattgttaacagtaggctaatatactgcacatgtttcattgt |
14612808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University