View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18747_high_34 (Length: 274)
Name: NF18747_high_34
Description: NF18747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18747_high_34 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 114; Significance: 7e-58; HSPs: 5)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 114; E-Value: 7e-58
Query Start/End: Original strand, 78 - 249
Target Start/End: Complemental strand, 17461830 - 17461663
Alignment:
| Q |
78 |
taatatgcatttacagctcaacctactcaaatttgtatacttaacactgcggattagatcaaacaaatagaacctcaatcagaacaaaaagacatggata |
177 |
Q |
| |
|
||||||||||||||| ||| |||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||| |||| |||| |
|
|
| T |
17461830 |
taatatgcatttacaactccacctactcaaatttgtatacttaacactacgaattagatcaaacaaatagaacctcaatcagaacaaaaa-acattgata |
17461732 |
T |
|
| Q |
178 |
ttagttgagtagtaagtcaatcagatgtctcaagaacaacattgttgaactctccatcacttgctcttggtc |
249 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||| ||||||||| |||||||||||||| ||||||| |
|
|
| T |
17461731 |
ttagttg---agtaagtcaatcagatgtctcaagaacagcattgttgagctctccatcacttgaccttggtc |
17461663 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 208 - 274
Target Start/End: Original strand, 17455171 - 17455237
Alignment:
| Q |
208 |
caagaacaacattgttgaactctccatcacttgctcttggtcctcagtccatgtaaccttgggcaga |
274 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
17455171 |
caagaacagcattgttgaactctccatcacttgatcttggtcatcagtccatgtaaccttgggcaga |
17455237 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 100 - 166
Target Start/End: Original strand, 17455098 - 17455164
Alignment:
| Q |
100 |
ctactcaaatttgtatacttaacactgcggattagatcaaacaaatagaacctcaatcagaacaaaa |
166 |
Q |
| |
|
|||||||||| ||||| |||| |||| || ||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
17455098 |
ctactcaaatctgtattcttagcactacgcattagatcaaacaaatagaccctcaatcagaacaaaa |
17455164 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 20 - 62
Target Start/End: Original strand, 17455026 - 17455068
Alignment:
| Q |
20 |
aaactttgttttacaagtatccattttagggaatgcttgcatg |
62 |
Q |
| |
|
||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
17455026 |
aaactttgtattacatgtatccattttagggaatgcttgcatg |
17455068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 26 - 62
Target Start/End: Complemental strand, 17461890 - 17461854
Alignment:
| Q |
26 |
tgttttacaagtatccattttagggaatgcttgcatg |
62 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||| |
|
|
| T |
17461890 |
tgttttacaagtatccattttatggaatgcttgcatg |
17461854 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 50; Significance: 1e-19; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 13 - 62
Target Start/End: Original strand, 774787 - 774836
Alignment:
| Q |
13 |
aatatctaaactttgttttacaagtatccattttagggaatgcttgcatg |
62 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
774787 |
aatatctaaactttgttttacaagtatccattttagggaatgcttgcatg |
774836 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University