View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF18747_high_36 (Length: 271)
Name: NF18747_high_36
Description: NF18747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF18747_high_36 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 118; Significance: 3e-60; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 118; E-Value: 3e-60
Query Start/End: Original strand, 20 - 137
Target Start/End: Complemental strand, 42750862 - 42750745
Alignment:
| Q |
20 |
gcaacggtggatctcaatggcacgcgagtgaaaatttggtgcaacaaatcatctgataaatatgttatgtcacaccttgaagacaacttagcaagtgaga |
119 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42750862 |
gcaacggtggatctcaatggcacgcgagtgaaaatttggtgcaacaaatcatctgataaatatgttatgtcacaccttgaagacaacttagcaagtgaga |
42750763 |
T |
 |
| Q |
120 |
tatcatgagccatatgag |
137 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
42750762 |
tatcatgagccatatgag |
42750745 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 209 - 261
Target Start/End: Complemental strand, 42750673 - 42750621
Alignment:
| Q |
209 |
ggagaaacaattgccgtcagttgcctggtttttattatatgttgcaagtatta |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42750673 |
ggagaaacaattgccgtcagttgcctggtttttattatatgttgcaagtatta |
42750621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 20 - 109
Target Start/End: Original strand, 42876017 - 42876106
Alignment:
| Q |
20 |
gcaacggtggatctcaatggcacgcgagtgaaaatttggtgcaacaaatcatctgataaatatgttatgtcacaccttgaagacaactta |
109 |
Q |
| |
|
|||||||| ||||| ||||||| || |||||||||||| || |||||||||||||| || ||||| |||||||||||||| |||| |
|
|
| T |
42876017 |
gcaacggttgatctggatggcacacgggtgaaaatttggcctaataaatcatctgataagtagtctatgtaacaccttgaagacagctta |
42876106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 44; Significance: 4e-16; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 65 - 128
Target Start/End: Original strand, 1050544 - 1050607
Alignment:
| Q |
65 |
aaatcatctgataaatatgttatgtcacaccttgaagacaacttagcaagtgagatatcatgag |
128 |
Q |
| |
|
|||||||||||||| ||||||||||||||| |||| |||||||||||| |||||||||||||| |
|
|
| T |
1050544 |
aaatcatctgataagtatgttatgtcacacattgatgacaacttagcagatgagatatcatgag |
1050607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University